मुख्यमंत्री पुष्कर धामी ने किया आपदा प्रभावित क्षेत्रों का दौरा, पीड़ित परिवारों को हर संभव मदद जा भरोसा दे अधिकारियों को दिए ये निर्देश

उत्तराखंड मौसम/आपदा राजनीति
खबर शेयर करें

उत्तरकाशी। मुख्यमंत्री पुष्कर सिंह धामी ने उत्तरकाशी पहुंचकर आपदा पीड़ितों से मुलाकात की। इस दौरान माण्डों गांव में आपदा में परिजन खो चुके परिवार के सदस्यों से मुख्यमंत्री ने मुलाकात कर हर संभव मदद का भरोसा दिया। साथ ही गांव का भूवैज्ञानिक से सर्वे कराकर विस्थापन पर भी जल्द निर्णय लेने की बात कही।

मुख्यमंत्री पुष्कर सिंह धामी ने आज बुधवार को उत्तरकाशी जिले के  मांडो गांव पहुंचकर आपदा से हुए नुकसान का जायजा लिया। इस दौरान आपदा प्रभावितों का हाल जाना। साथ ही आपदा में मृतक लोगों के परिजनों से भी मिले। सबसे ज्यादा नुकसान मांडो गांव में हुआ। जहां पर 15 से 20 घरों में मलबा घुस गया था।

करीब चार से पांच मकान जमींदोज को हो गए। मांडो गांव मकान जमींदोज होने से दो महिलाओं और एक बच्ची की मौत हो गई थी। उनके साथ उत्तरकाशी जिले के प्रभारी मंत्री गणेश जोशी और भाजपा नेेता किशोर भट्ट भी शामिल रहे।

मुख्यमंत्री ने आपदा पीड़ितों के घर जाकर हालचाल जाने। साथ ही कहा कि सरकार उनकी हर संभव मदद करेगी। मुख्यमंत्री ने कहा कि ग्रामीणों की मांग पर माण्डो गांव के विस्थापन की प्रक्रिया शुरू करने के डीएम को निर्देश दिए हैं। जल्द भूवैज्ञानिक सर्वे कराने के बाद विस्थापन की कार्रवाई की जाएगी।

मांडो गांव के बाद मुख्यमंत्री  कंकराड़ी गांव पहुंचे। जहां उन्होंने मिर्तक सुमन के परिजनों से मुलाकात की ओर परिवार को सांत्वना देकर उन्हें  उनकी आग पर सरकारी सेवा में लगाने का अस्वाशन दिया।

सीएम ने अतिवृष्टि से हुए नुकसान के बाद मांडो गांव पहुंचकर राहत व बचाव कार्य का जायजा लिया। उन्होंने मृतकों के परिजनों को सांत्वना भी दी। उन्होंने अधिकारियों को सख्त निर्देश दिए हैं आपदा के बाद राहत कार्य में तेजी लाई जाए। कहा कि आपदा के दौरान राहत व बचाव कार्यों को तुरंत ही शुरू किया जाए, ताकि लोगों की जान बचाई जा सके।

कहा कि  मानसून के दौरान राज्य में किसी अप्रिय घटना और आपदा की स्थिति से निपटने के लिए राहत और बचाव कार्य को लेकर तत्काल इंतजाम होने चाहिए। सीएम पुष्कर ने अधिकारियों को सख्त हिदायत दी कि वे हमेशा अलर्ट मोड में रहें और राहत-बचाव कार्य में कार्यवाही जल्द से जल्द शुरू कराएं।रिस्पांस टाइम त्वरित होना चाहिए।

सीएम ने आपदा प्रबंधन में सभी संबंधित विभागों और एजेंसियों में पूर्ण समन्वय बनाकर कार्य करने की सलाह भी दी। कहा कि किसी तरह की की संवादहीनता नहीं रहनी चाहिए। समय समय पर माक ड्रिल अवश्य की जाए। आपदा कंट्रोल रूम निरंतर एक्टिव रहे। अवरूद्ध मार्गों, क्षतिग्रस्त बिजली और पेयजल लाईनों को जल्द से जल्द बहाल करें।

सीएम ने मुख्यमंत्री ने पूर्व में आई आपदाओं में किये गये राहत व बचाव कार्यों की भी जानकारी ली।कहा कि जिन परिवारों का सुरक्षित स्थानों पर विस्थापन किया जाना है, उनमें प्रक्रियाओं में किसी तरह का विलम्ब न हो।

34 thoughts on “मुख्यमंत्री पुष्कर धामी ने किया आपदा प्रभावित क्षेत्रों का दौरा, पीड़ित परिवारों को हर संभव मदद जा भरोसा दे अधिकारियों को दिए ये निर्देश

  1. According to the present invention, it is administered at a dose of 10 mg kg weekly preferably for 3 4 weeks prior to the administration of the cellular immunotherapies priligy united states Teriparatide produces increases in bone mass and mediates architectural improvements in skeletal structure

  2. I have learn some excellent stuff here. Definitely value bookmarking for revisiting. I wonder how a lot attempt you put to create this sort of excellent informative site.

  3. The second set of primers annealed to the IRES and the floxed LacZ sequence sense primer is P1 and reverse primer is within LacZ P3 5 AGGGAGATCGCACTCCAGCC 3 stromectol france my libido was doing well during the first two weeks of pct i started oct 2 weeks after last shot i dont see how running with the Dr Max Powers testosterone Boost could hurt

  4. By doing the following 10 15 minutes HIIT followed by 15 30 minutes of low intensity cardio buy clomid and nolvadex online The results of the primary composite endpoint were consistent across the subgroups examined, including CKD patients with and without type 2 diabetes mellitus, causes of CKD, age, biological sex, race, UACR, and eGFR

  5. A totally repaired congenital heart defect, repaired with prosthetic material or device that has been placed by surgery or catheter intervention during the first six months after the procedure natural lasix

Leave a Reply

Your email address will not be published.